clk kinase inhibitor sirna (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
clk kinase inhibitor sirna
Clk Kinase Inhibitor Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clk+kinase+inhibitor/pmc04505053-111-9-13
Average 90 stars, based on 1 article reviews
Clk Kinase Inhibitor Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clk+kinase+inhibitor/pmc04505053-111-9-13
Average 90 stars, based on 1 article reviews
clk kinase inhibitor sirna - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Transfection:Article Title: Increased Serine-Arginine (SR) Protein Phosphorylation Changes Pre-mRNA Splicing in Hypoxia Article Snippet: Quantitative PCR was done with primer pair (CLK1-HRE forward 5 -d(CGTACAGGTCTGCAGCAACCTC)-3 /CLK1-HRE reverse d(5 -GCCTCACCCTCTCCT TCTGC-3 )) using Maxima SYBR Green qPCR Master mix (ThermoFisher Scientific) on Qiagene Rotor-Gene 6000. .. HeLa Cell Transfections with CLK1 siRNA or Treatment with Inhibition:Article Title: Increased Serine-Arginine (SR) Protein Phosphorylation Changes Pre-mRNA Splicing in Hypoxia Article Snippet: Quantitative PCR was done with primer pair (CLK1-HRE forward 5 -d(CGTACAGGTCTGCAGCAACCTC)-3 /CLK1-HRE reverse d(5 -GCCTCACCCTCTCCT TCTGC-3 )) using Maxima SYBR Green qPCR Master mix (ThermoFisher Scientific) on Qiagene Rotor-Gene 6000. .. HeLa Cell Transfections with CLK1 siRNA or Treatment with |